Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04062
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209547
Product ID ORK04062
Clone name fk12161
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AFF4
cDNA sequence DNA sequence (3348 bp)
Predicted protein sequence (907 aa)
Description AF4/FMR2 family member 4 (ALL1-fused gene from chromosome 5q31) (Major CDK9 elongation factor-associated protein).
Features of the cloned cDNA sequence

Length: 3348 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 281 bp
Genome contig ID gi51511721r_132155534
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGTGAGACCCTGTCTGTAAAAGAACTTTAAAATTT
Flanking genome sequence
(99874 - 99825)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGATAGAAACCAGTCATTGGAAAAGTTGGTTATGG

Features of the protein sequence

Length: 907 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92784 0 100.0 ALL1 fused gene...
Homo sapiens
XP_001164447 0 99.7 ALL1 fused gene...
Pan troglodytes
XP_001105647 0 99.0 similar to ALL1...
Macaca mulatta
Q9UHB7 0 98.3 AF4/FMR2 family...
Homo sapiens
XP_001164760 0 98.1 ALL1 fused gene...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007797 9 907 PF05110 AF-4 proto-oncoprotein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp