Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04079
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209821
Product ID ORK04079
Clone name bm04613
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ALDH1A1
cDNA sequence DNA sequence (2086 bp)
Predicted protein sequence (330 aa)
Description Retinal dehydrogenase 1 (EC 1.2.1.36) (RalDH1) (RALDH 1) (Aldehyde dehydrogenase family 1 member A1) (Aldehyde dehydrogenase, cytosolic) (ALHDII) (ALDH-E1).
Features of the cloned cDNA sequence

Length: 2086 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1092 bp
Genome contig ID gi89161216r_74605408
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTGAATATAAAGCTTAATAAAAACAACCTTGCATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTTGTTACTTTTGAATTTTTTTAAGTACAAGTTTTGGTTACAGTGAT

Features of the protein sequence

Length: 330 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93058 2.6e-138 100.0 aldehyde dehydr...
Homo sapiens
XP_001143065 4.8e-129 100.0 aldehyde dehydr...
Pan troglodytes
XP_001143308 4.9e-129 100.0 aldehyde dehydr...
Pan troglodytes
XP_001143226 5e-129 100.0 aldehyde dehydr...
Pan troglodytes
P00352 5.2e-129 100.0 Retinal dehydro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002086 43 330 PF00171 Aldehyde dehydrogenase
ScanRegExp IPR002086 282 289 PS00687 Aldehyde dehydrogenase
IPR002086 310 321 PS00070 Aldehyde dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp