ORK04080

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04080

Order Kazusa clone(s) from :

Accession No	AB209299
Product ID	ORK04080
Clone name	fk07620
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ALDH1L1
cDNA sequence	DNA sequence (3084 bp) Predicted protein sequence (954 aa)
Description	10-formyltetrahydrofolate dehydrogenase (EC 1.5.1.6) (10-FTHFDH) (Aldehyde dehydrogenase 1 family member L1).

Features of the cloned cDNA sequence

Description

Length: 3084 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	218 bp
Genome contig ID	gi89161205r_127205106
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTGCCCCTCCCAGGGAGAATAAAGCTTCTGAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACCGTCCACATCTCTGCGTTTCTCTGCTCCACCTGTGGGTGTTCCTGG

Features of the protein sequence

Description

Length: 954 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92536	100.0	aldehyde dehydr...	Homo sapiens
XP_001108084	97.0	similar to alde...	Macaca mulatta
XP_516714	96.7	aldehyde dehydr...	Pan troglodytes
CAH18667	99.8	hypothetical pr...	Homo sapiens
O75891	99.8	10-formyltetrah...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002376	53	232	PF00551	Formyl transferase
	IPR005793	257	362	PF02911	Formyl transferase
	IPR002086	482	950	PF00171	Aldehyde dehydrogenase
ProfileScan	IPR006163	375	444	PS50075	Phosphopantetheine-binding
ScanRegExp	IPR001555	183	206	PS00373	Phosphoribosylglycinamide formyltransferase
	IPR002086	724	731	PS00687	Aldehyde dehydrogenase
	IPR002086	752	763	PS00070	Aldehyde dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp