Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04081
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208894
Product ID ORK04081
Clone name fk09458
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ALDH3A2
cDNA sequence DNA sequence (3212 bp)
Predicted protein sequence (461 aa)
Description Fatty aldehyde dehydrogenase (EC 1.2.1.3) (Aldehyde dehydrogenase, microsomal) (Aldehyde dehydrogenase family 3 member A2) (Aldehyde dehydrogenase 10).
Features of the cloned cDNA sequence

Length: 3212 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1825 bp
Genome contig ID gi51511734f_19392948
PolyA signal sequence
(CATAAA,-25)
+----*----+----*----+----*----+----
AGAGAGTAATCATAAAATACCTTAGATAAAATTGC
Flanking genome sequence
(128356 - 128405)
----+----*----+----*----+----*----+----*----+----*
ACTATGGAATTTTCATTGAGTATGTTTAAATTATTGGCTTGTCTACTAAT

Features of the protein sequence

Length: 461 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92131 2.6e-197 100.0 aldehyde dehydr...
Homo sapiens
P51648 2.7e-197 100.0 Fatty aldehyde ...
Homo sapiens
Q5RF60 2.4e-196 99.3 Fatty aldehyde ...
Pongo abelii
AAC50965 1.9e-195 100.0 fatty aldehyde ...
Homo sapiens
AAP36923 1.9e-195 100.0 aldehyde dehydr...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002086 1 401 PF00171 Aldehyde dehydrogenase
ScanRegExp IPR002086 182 189 PS00687 Aldehyde dehydrogenase
IPR002086 210 221 PS00070 Aldehyde dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp