Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04103
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209308
Product ID ORK04103
Clone name fh00964
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ANK3
cDNA sequence DNA sequence (5071 bp)
Predicted protein sequence (931 aa)
Description Ankyrin-3 (ANK-3) (Ankyrin-G).
Features of the cloned cDNA sequence

Length: 5071 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 540 bp
Genome contig ID gi89161187r_61413703
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCAAACCCAGTGAGCATGTAAGTATCTAACAGTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGCTTTCAAAATCTATACGAATAAGTGATTGATGTC

Features of the protein sequence

Length: 931 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92545 0 100.0 ankyrin 3 isofo...
Homo sapiens
XP_858597 0 95.0 similar to anky...
Canis lupus fam...
EDL97284 0 94.2 ankyrin 3, epit...
Rattus norvegicus
AAB01604 0 94.1 ankyrin 3 [Mus ...
Mus musculus
EDL31994 0 94.1 ankyrin 3, epit...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 76 88 PR01415 Ankyrin
IPR002110 88 100 PR01415 Ankyrin
HMMPfam IPR002110 9 41 PF00023 Ankyrin
IPR002110 42 74 PF00023 Ankyrin
IPR002110 75 107 PF00023 Ankyrin
IPR002110 108 140 PF00023 Ankyrin
IPR002110 141 173 PF00023 Ankyrin
IPR002110 174 206 PF00023 Ankyrin
IPR002110 207 239 PF00023 Ankyrin
IPR002110 240 272 PF00023 Ankyrin
IPR002110 273 305 PF00023 Ankyrin
IPR002110 306 338 PF00023 Ankyrin
IPR002110 339 359 PF00023 Ankyrin
IPR000906 515 619 PF00791 ZU5
HMMSmart IPR002110 9 38 SM00248 Ankyrin
IPR002110 42 71 SM00248 Ankyrin
IPR002110 75 104 SM00248 Ankyrin
IPR002110 108 137 SM00248 Ankyrin
IPR002110 141 170 SM00248 Ankyrin
IPR002110 174 203 SM00248 Ankyrin
IPR002110 207 236 SM00248 Ankyrin
IPR002110 240 269 SM00248 Ankyrin
IPR002110 273 302 SM00248 Ankyrin
IPR002110 306 335 SM00248 Ankyrin
IPR000906 515 619 SM00218 ZU5
ProfileScan IPR002110 9 41 PS50088 Ankyrin
IPR002110 9 359 PS50297 Ankyrin
IPR002110 42 74 PS50088 Ankyrin
IPR002110 75 107 PS50088 Ankyrin
IPR002110 108 140 PS50088 Ankyrin
IPR002110 141 173 PS50088 Ankyrin
IPR002110 174 206 PS50088 Ankyrin
IPR002110 207 239 PS50088 Ankyrin
IPR002110 240 272 PS50088 Ankyrin
IPR002110 273 305 PS50088 Ankyrin
IPR002110 306 338 PS50088 Ankyrin
IPR000906 515 622 PS51145 ZU5
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp