ORK04118

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04118

Order Kazusa clone(s) from :

Accession No	AB209808
Product ID	ORK04118
Clone name	bm03991
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	AP1M1
cDNA sequence	DNA sequence (2311 bp) Predicted protein sequence (466 aa)
Description	AP-1 complex subunit mu-1 (Adaptor-related protein complex 1 mu-1 subunit) (Mu-adaptin 1) (Adaptor protein complex AP-1 mu-1 subunit) (Golgi adaptor HA1/AP1 adaptin mu-1 subunit) (Clathrin assembly protein assembly protein complex 1 medium chain 1) (AP-mu

Features of the cloned cDNA sequence

Description

Length: 2311 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	910 bp
Genome contig ID	gi42406306f_16069745
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- TCATAGTTACATTAAATTCCATTCATTGAATACTC
Flanking genome sequence (137413 - 137462)	----+--------+--------+--------+--------+----* CACAGCCTTCCTCTGATGCAGCGTGGTCCCAACTCCTCCTGCGTGACCAC

Features of the protein sequence

Description

Length: 466 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93045	6.6e-204	100.0	adaptor-related...	Homo sapiens
AAY54246	2.2e-187	100.0	leukemia T cell...	Homo sapiens
XP_001502868	1.4e-184	98.8	similar to adap...	Equus caballus
XP_865989	3.6e-177	96.1	similar to adap...	Canis lupus fam...
XP_866004	4.9e-177	95.9	similar to adap...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001392	44	64	PR00314	Clathrin adaptor
	IPR001392	131	158	PR00314	Clathrin adaptor
	IPR001392	190	218	PR00314	Clathrin adaptor
	IPR001392	276	303	PR00314	Clathrin adaptor
	IPR001392	345	360	PR00314	Clathrin adaptor
	IPR001392	385	396	PR00314	Clathrin adaptor
HMMPfam	IPR008968	188	465	PF00928	Clathrin adaptor
ProfileScan	IPR008968	196	465	PS51072	Clathrin adaptor
ScanRegExp	IPR001392	188	208	PS00990	Clathrin adaptor
ScanRegExp	IPR001392	296	310	PS00991	Clathrin adaptor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp