Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04126
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208846
Product ID ORK04126
Clone name fh25089
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol APOB
cDNA sequence DNA sequence (5150 bp)
Predicted protein sequence (1615 aa)
Description Apolipoprotein B-100 precursor (Apo B-100) [Contains: Apolipoprotein B-48 (Apo B-48)].
Features of the cloned cDNA sequence

Length: 5150 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 300 bp
Genome contig ID gi89161199r_20977807
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AGGAACAAATAAATGGAGTCTTTATTGTGTATCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCACTGAATGTGGCTCATTTGTATTGAAAGACAGTGAAACGAGGGCATT

Features of the protein sequence

Length: 1615 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92083 0 100.0 Apolipoprotein ...
Homo sapiens
NP_000375 0 99.9 apolipoprotein ...
Homo sapiens
AAB00481 0 99.8 apolipoprotein ...
Homo sapiens
1211338A 0 99.5 lipoprotein B100.
Homo sapiens
AAA35549 0 99.5 apolipoprotein ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp