Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04182
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209786
Product ID ORK04182
Clone name bm02724
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ARRB2
cDNA sequence DNA sequence (1693 bp)
Predicted protein sequence (410 aa)
Description Beta-arrestin-2 (Arrestin beta 2).
Features of the cloned cDNA sequence

Length: 1693 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 460 bp
Genome contig ID gi51511734f_4460732
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCATAAAGAAGAAAATAAATCTTTTACTAAGCATG
Flanking genome sequence
(110813 - 110862)
----+----*----+----*----+----*----+----*----+----*
AGTGTGTGTTTTCTCTGTAGTGTTTAGAGAGTGTATGGTGTGCTTATCCA

Features of the protein sequence

Length: 410 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93023 1.7e-174 100.0 arrestin beta 2...
Homo sapiens
Q5RCR4 5.9e-166 97.2 Beta-arrestin-2...
Pongo abelii
XP_511287 1.5e-165 97.0 arrestin beta 2...
Pan troglodytes
CAG29306 2.3e-165 97.0 ARRB2 [Homo sap...
Homo sapiens
CAA77577 2.7e-165 97.0 arrestin [Homo ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000698 19 182 PD002099 Arrestin
IPR000698 186 400 PD002099 Arrestin
FPrintScan IPR000698 26 48 PR00309 Arrestin
IPR000698 63 81 PR00309 Arrestin
IPR000698 157 174 PR00309 Arrestin
IPR000698 282 300 PR00309 Arrestin
IPR000698 384 398 PR00309 Arrestin
HMMPfam IPR011021 20 176 PF00339 Arrestin-like
IPR011022 195 350 PF02752 Arrestin-like
ScanRegExp IPR000698 63 81 PS00295 Arrestin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp