Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04199
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209032
Product ID ORK04199
Clone name hh01039
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATF3
cDNA sequence DNA sequence (5656 bp)
Predicted protein sequence (101 aa)
Description Cyclic AMP-dependent transcription factor ATF-3 (Activating transcription factor 3).
Features of the cloned cDNA sequence

Length: 5656 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1217 bp
Genome contig ID gi89161185f_210755080
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TGTCAGAATAATAAATATTGGAACCAAGACATGGT
Flanking genome sequence
(105659 - 105708)
----+----*----+----*----+----*----+----*----+----*
AAACATGTGTTGTGCTGGTTTCTGTTCATTTAAATCTGTCGGTTGCTGAG

Features of the protein sequence

Length: 101 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92269 2.5e-35 100.0 activating tran...
Homo sapiens
EAW93383 2.7e-18 98.5 activating tran...
Homo sapiens
CAH72657 6e-18 98.4 activating tran...
Homo sapiens
AAP92420 6e-18 98.4 activating tran...
Mus musculus
XP_001107862 7e-18 98.4 activating tran...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp