ORK04221

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04221

Order Kazusa clone(s) from :

Accession No	AB208806
Product ID	ORK04221
Clone name	ag00032
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATP6V1B2
cDNA sequence	DNA sequence (6907 bp) Predicted protein sequence (319 aa)
Description	Vacuolar ATP synthase subunit B, brain isoform (EC 3.6.3.14) (V-ATPase subunit B 2) (Vacuolar proton pump subunit B 2) (Endomembrane proton pump 58 kDa subunit) (HO57).

Features of the cloned cDNA sequence

Description

Length: 6907 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5946 bp
Genome contig ID	gi51511724f_19999194
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGATATAAAATGAAAATAAATGTTAAATTAAATGG
Flanking genome sequence (124288 - 124337)	----+--------+--------+--------+--------+----* ACCTTAACTAAAGTGACTCTCTATCTTCTAACGAGGAAAGCAACAAGCAA

Features of the protein sequence

Description

Length: 319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92043	3.5e-128	100.0	ATPase, H+ tran...	Homo sapiens
XP_001100869	4e-124	99.6	vacuolar H+ATPa...	Macaca mulatta
AAA58661	4.4e-124	100.0	vacuolar H+-ATP...	Homo sapiens
P21281	4.4e-124	100.0	V-type proton A...	Homo sapiens
AAP36494	4.4e-124	100.0	ATPase, H+ tran...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004100	51	117	PF02874	ATPase
HMMPfam	IPR000194	173	312	PF00006	ATPase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp