ORK04243

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04243

Order Kazusa clone(s) from :

Accession No	AB209046
Product ID	ORK04243
Clone name	hj00087
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	B3GALNT2
cDNA sequence	DNA sequence (4273 bp) Predicted protein sequence (427 aa)
Description	UDP-GalNAc:beta-1,3-N-acetylgalactosaminyltransferase 2 (EC 2.4.1.-) (Beta-1,3-N-acetylgalactosaminyltransferase II) (Beta-3-GalNAc-T2).

Features of the cloned cDNA sequence

Description

Length: 4273 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2987 bp
Genome contig ID	gi89161185r_233577156
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CAACTTGTGATAATAAATGTTCTTTATTTTAGAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACTGGCCTTTTTGTATGTATTGAATACAGTTAATAGAATTTATAAT

Features of the protein sequence

Description

Length: 427 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92283	3.2e-195	100.0	UDP-GalNAc:beta...	Homo sapiens
Q8NCR0	3.7e-195	100.0	UDP-GalNAc:beta...	Homo sapiens
XP_525099	3.7e-195	100.0	UDP-GalNAc:beta...	Pan troglodytes
XP_001101191	5.3e-186	95.3	similar to UDP-...	Macaca mulatta
XP_001491595	2.3e-183	93.9	beta-1,3-N-acet...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002659	218	385	PF01762	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	70	RVVSVSFRVLYPIVITSLGVFYD	92	PRIMARY	23