ORK04244

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04244

Order Kazusa clone(s) from :

Accession No	AB209517
Product ID	ORK04244
Clone name	fk09284
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	B3GNT5
cDNA sequence	DNA sequence (3936 bp) Predicted protein sequence (365 aa)
Description	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 (EC 2.4.1.-) (Beta3Gn-T5) (BGnT-5) (Beta1,3-N- Acetylglucosaminyltransferase-5) (Lactotriaosylceramide synthase) (Lc(3)Cer synthase) (Lc3 synthase).

Features of the cloned cDNA sequence

Description

Length: 3936 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2496 bp
Genome contig ID	gi89161205f_184353908
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAAATCTATAGTTTCCAATAAACAACTGAAAAATT
Flanking genome sequence (119960 - 120009)	----+--------+--------+--------+--------+----* ATCATGAGATGTGTATTTAAACTTTTTCATGAACATTGCTTATATAATCA

Features of the protein sequence

Description

Length: 365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92754	1.1e-164	100.0	beta-1,3-N-acet...	Homo sapiens
Q9BYG0	4.6e-157	100.0	UDP-GlcNAc:beta...	Homo sapiens
BAG52370	1.2e-156	99.7	unnamed protein...	Homo sapiens
CAC83093	4.2e-156	100.0	Gal-beta1-3 Glc...	Homo sapiens
XP_001106314	4.8e-151	95.9	similar to UDP-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002659	104	303	PF01762	Glycosyl transferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp