ORK04246

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04246

Order Kazusa clone(s) from :

Accession No	AB209460
Product ID	ORK04246
Clone name	ah03205
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	B4GALNT1
cDNA sequence	DNA sequence (5580 bp) Predicted protein sequence (474 aa)
Description	Beta-1,4 N-acetylgalactosaminyltransferase 1 (EC 2.4.1.92) ((N- acetylneuraminyl)-galactosylglucosylceramide) (GM2/GD2 synthase) (GalNAc-T).

Features of the cloned cDNA sequence

Description

Length: 5580 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3849 bp
Genome contig ID	gi89161190r_56203460
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGTGAAAAAAATAAGAATTTTATCTCTTAAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTATAGTTTTGTGTTTTTATTTTGAACCACACCTGGGGCACCATAAA

Features of the protein sequence

Description

Length: 474 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92697	9.5e-186	100.0	UDP-N-acetyl-al...	Homo sapiens
Q00973	6.6e-147	91.3	Beta-1,4 N-acet...	Homo sapiens
EAW97042	1.2e-146	91.1	beta-1,4-N-acet...	Homo sapiens
XP_001116271	1.2e-144	89.9	beta-1,4-N-acet...	Macaca mulatta
XP_538250	6.8e-131	83.8	similar to Beta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001173	305	463	PF00535	Glycosyl transferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp