Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04247
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209194
Product ID ORK04247
Clone name fj02796
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol B4GALT6
cDNA sequence DNA sequence (4147 bp)
Predicted protein sequence (122 aa)
Description Beta-1,4-galactosyltransferase 6 (EC 2.4.1.-) (Beta-1,4-GalTase 6) (Beta4Gal-T6) (b4Gal-T6) (UDP-galactose:beta-N-acetylglucosamine beta- 1,4-galactosyltransferase 6) (UDP-Gal:beta-GlcNAc beta-1,4- galactosyltransferase 6) [Includes: Lactosylceramide synt
Features of the cloned cDNA sequence

Length: 4147 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1356 bp
Genome contig ID gi51511735r_27356208
PolyA signal sequence
(AATATA,-17)
+----*----+----*----+----*----+----
TATCATTGTCTTTTATGAAATATAATGTTCTAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTGTGAAGATGTAATTATTTTCCTCTCAGGAACTTTTTTGGGTTA

Features of the protein sequence

Length: 122 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92431 1.3e-52 100.0 UDP-Gal:betaGlc...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp