Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04256
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208905
Product ID ORK04256
Clone name ph00583
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol BBS2
cDNA sequence DNA sequence (6070 bp)
Predicted protein sequence (321 aa)
Description Bardet-Biedl syndrome 2 protein.
Features of the cloned cDNA sequence

Length: 6070 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5102 bp
Genome contig ID gi51511732r_54975801
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GATTATCTACTTTTTCATTAAAATGTAAAGATGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTTGTGTTGATTGATTATAAAATCACCACCAAATCAGAATTGCCCA

Features of the protein sequence

Length: 321 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92142 6.9e-136 100.0 Bardet-Biedl sy...
Homo sapiens
Q9BXC9 1.2e-114 97.5 Bardet-Biedl sy...
Homo sapiens
XP_510980 1.2e-114 97.5 Bardet-Biedl sy...
Pan troglodytes
CAH92361 1.6e-114 97.5 hypothetical pr...
Pongo abelii
NP_114091 3.2e-114 97.1 bardet-Biedl sy...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013517 166 195 PF01839 FG-GAP
IPR013517 247 276 PF01839 FG-GAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp