Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04293
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226064
Product ID ORK04293
Clone name ak00172
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NACC1
cDNA sequence DNA sequence (3296 bp)
Predicted protein sequence (183 aa)
Description BTB/POZ domain-containing protein 14B (Nucleus accumbens-1) (NAC-1).
Features of the cloned cDNA sequence

Length: 3296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2742 bp
Genome contig ID gi42406306f_13008130
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GATACTGATGAGAATAAACTAAACGCCTTTGTAAC
Flanking genome sequence
(104830 - 104879)
----+----*----+----*----+----*----+----*----+----*
AGCCTTGCCGCATGCTCGTTACTTGGGGGCCCAGGGAGGAACACACACCT

Features of the protein sequence

Length: 183 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96RE7 7.9e-81 100.0 Nucleus accumbe...
Homo sapiens
XP_001504926 1e-76 94.5 BTB (POZ) domai...
Equus caballus
XP_001366862 1.1e-75 92.3 similar to NAC1...
Monodelphis dom...
XP_603731 1.3e-75 94.5 similar to tran...
Bos taurus
O35260 6e-74 91.3 Nucleus accumbe...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR009552 1 108 PF06665 Protein of unknown function DUF1172
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp