ORK04444

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04444

Order Kazusa clone(s) from :

Accession No	AB209306
Product ID	ORK04444
Clone name	fh00181
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CBFA2T2
cDNA sequence	DNA sequence (5205 bp) Predicted protein sequence (386 aa)
Description	Protein CBFA2T2 (MTG8-like protein) (MTG8-related protein 1) (Myeloid translocation-related protein 1) (ETO homologous on chromosome 20) (p85).

Features of the cloned cDNA sequence

Description

Length: 5205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3938 bp
Genome contig ID	gi51511747f_31576057
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTACTTAAAGTAGTCAATAAAAAGGCTATATTCCT
Flanking genome sequence (125442 - 125491)	----+--------+--------+--------+--------+----* TTTCTGCCTCAAGCTGGAATGGGACCGGGAGGAAAGGTGGTCCCTACACT

Features of the protein sequence

Description

Length: 386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92543	8.7e-152	100.0	myeloid translo...	Homo sapiens
XP_001158232	4.1e-144	99.4	core-binding fa...	Pan troglodytes
EAW76313	6e-142	98.9	core-binding fa...	Homo sapiens
AAH16298	3.3e-141	99.7	CBFA2T2 protein...	Homo sapiens
AAC19378	3.7e-141	99.7	EHT protein [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013291	92	104	PR01877	Myeloid transforming gene related protein-1 (MTGR1)
	IPR013291	194	204	PR01877	Myeloid transforming gene related protein-1 (MTGR1)
	IPR013289	229	257	PR01875	Eight-Twenty-One
	IPR013289	300	328	PR01875	Eight-Twenty-One
	IPR013291	345	365	PR01877	Myeloid transforming gene related protein-1 (MTGR1)
	IPR013291	373	382	PR01877	Myeloid transforming gene related protein-1 (MTGR1)
HMMPfam	IPR014896	114	180	PF08788	NHR2-like
HMMPfam	IPR002893	289	325	PF01753	Zinc finger
ProfileScan	IPR002893	289	325	PS50865	Zinc finger
ScanRegExp	IPR002893	289	325	PS01360	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp