ORK04488

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04488

Order Kazusa clone(s) from :

Accession No	AB209728
Product ID	ORK04488
Clone name	bm03134
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CCT6A
cDNA sequence	DNA sequence (2496 bp) Predicted protein sequence (529 aa)
Description	T-complex protein 1 subunit zeta (TCP-1-zeta) (CCT-zeta) (CCT-zeta-1) (Tcp20) (HTR3) (Acute morphine dependence-related protein 2).

Features of the cloned cDNA sequence

Description

Length: 2496 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	904 bp
Genome contig ID	gi89161213f_55987040
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGTGAGTTGTGCAATAAATGTTAAGTTGAAACCTC
Flanking genome sequence (112138 - 112187)	----+--------+--------+--------+--------+----* CTTTCTGTTCTTGCAATGGTATGACGCACAAAAGCAATCTTAAGGGGAAT

Features of the protein sequence

Description

Length: 529 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92965	3.1e-210	100.0	chaperonin cont...	Homo sapiens
P40227	3.4e-209	99.8	T-complex prote...	Homo sapiens
BAG36555	1.3e-208	99.6	unnamed protein...	Homo sapiens
BAB61032	2.8e-208	99.4	acute morphine ...	Homo sapiens
Q5RCD2	6e-208	99.4	T-complex prote...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	30	46	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	32	58	PR00298	Chaperonin Cpn60
	IPR002423	52	70	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	82	101	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	84	111	PR00298	Chaperonin Cpn60
	IPR002423	371	393	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	391	412	PR00298	Chaperonin Cpn60
	IPR002423	405	417	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	28	524	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012722	1	528	TIGR02347	T-complex protein 1
ScanRegExp	IPR002194	33	45	PS00750	Chaperonin TCP-1
	IPR002194	54	70	PS00751	Chaperonin TCP-1
	IPR002194	82	90	PS00995	Chaperonin TCP-1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp