Length: 5235 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
619 bp |
Genome contig ID |
gi51511727f_2269189 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- CCGTCATTTAATAAAGAAGGAACATCAGGCATGCT |
Flanking genome sequence (106015 - 106064) |
----+----*----+----*----+----*----+----*----+----* ACCAGGCCTGTGCAGTCCCTCAGTGCCAGTGGTGTCTGAGACCTAGGGGT |
Length: 108 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92617 |
3.2e-47 |
100.0 |
CD81 antigen va...
|
Homo sapiens
|
EDL18193 |
4.1e-06 |
88.2 |
CD 81 antigen, ...
|
Mus musculus
|
CAB94774 |
5.3e-06 |
88.2 |
Tapa-1 protein ...
|
Mus musculus
|
BAE22950 |
5.3e-06 |
88.2 |
unnamed protein...
|
Mus musculus
|
P35762 |
5.3e-06 |
88.2 |
CD81 antigen; 2...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
71 |
SGKLYLIGIAAIVVAVIMVSGR |
92 |
PRIMARY |
22 |