Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04497
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209380
Product ID ORK04497
Clone name fh19105
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CD81
cDNA sequence DNA sequence (5235 bp)
Predicted protein sequence (108 aa)
Description CD81 antigen (26 kDa cell surface protein TAPA-1) (Target of the antiproliferative antibody 1) (Tetraspanin-28) (Tspan-28).
Features of the cloned cDNA sequence

Length: 5235 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 619 bp
Genome contig ID gi51511727f_2269189
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CCGTCATTTAATAAAGAAGGAACATCAGGCATGCT
Flanking genome sequence
(106015 - 106064)
----+----*----+----*----+----*----+----*----+----*
ACCAGGCCTGTGCAGTCCCTCAGTGCCAGTGGTGTCTGAGACCTAGGGGT

Features of the protein sequence

Length: 108 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92617 3.2e-47 100.0 CD81 antigen va...
Homo sapiens
EDL18193 4.1e-06 88.2 CD 81 antigen, ...
Mus musculus
CAB94774 5.3e-06 88.2 Tapa-1 protein ...
Mus musculus
BAE22950 5.3e-06 88.2 unnamed protein...
Mus musculus
P35762 5.3e-06 88.2 CD81 antigen; 2...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 71 SGKLYLIGIAAIVVAVIMVSGR 92 PRIMARY 22
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp