Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04555
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209459
Product ID ORK04555
Clone name ah03145
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CHI3L1
cDNA sequence DNA sequence (6239 bp)
Predicted protein sequence (154 aa)
Description Chitinase-3-like protein 1 precursor (Cartilage glycoprotein 39) (GP- 39) (39 kDa synovial protein) (HCgp-39) (YKL-40).
Features of the cloned cDNA sequence

Length: 6239 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 586 bp
Genome contig ID gi89161185r_201314689
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TAATTCCACAGCTGCTCAATAAAGTACAAGAGCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAGTGTGTTGGCGCTTTGCTTTGGTCTATCTTTGAGCGCCCACTAGAC

Features of the protein sequence

Length: 154 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92696 2e-61 100.0 chitinase 3-lik...
Homo sapiens
BAG53058 7e-46 97.5 unnamed protein...
Homo sapiens
1HJV 4.8e-10 68.1

XP_001153571 4.8e-10 68.1 chitinase 3-lik...
Pan troglodytes
P36222 5e-10 68.1 Chitinase-3-lik...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001223 37 82 PF00704 Glycoside hydrolase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp