Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04578
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209115
Product ID ORK04578
Clone name hh12796
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CLIP1
cDNA sequence DNA sequence (4639 bp)
Predicted protein sequence (1065 aa)
Description CAP-Gly domain-containing linker protein 1 (Restin) (Cytoplasmic linker protein 170 alpha-2) (CLIP-170) (Reed-Sternberg intermediate filament-associated protein) (Cytoplasmic linker protein 1).
Features of the cloned cDNA sequence

Length: 4639 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1441 bp
Genome contig ID gi89161190r_121221934
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTTCTGTATCTACTTTAATAAATGGTTATTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTGTTTTGTGGGTTTTGTTTTGTTTGAGACAGGGTCTCACTCTGTTGCC

Features of the protein sequence

Length: 1065 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92352 0 100.0 restin isoform ...
Homo sapiens
XP_001167046 0 99.4 similar to rest...
Pan troglodytes
XP_001167071 0 99.2 similar to rest...
Pan troglodytes
XP_001097802 0 98.7 restin (Reed-St...
Macaca mulatta
XP_859535 0 91.3 similar to rest...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000938 1 30 PF01302 CAP-Gly
ProfileScan IPR000938 1 25 PS50245 CAP-Gly
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp