Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04621
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208884
Product ID ORK04621
Clone name fk13966
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CPT1C
cDNA sequence DNA sequence (2949 bp)
Predicted protein sequence (400 aa)
Description Carnitine O-palmitoyltransferase I, brain isoform (EC 2.3.1.21) (Carnitine palmitoyltransferase 1C) (CPT IC).
Features of the cloned cDNA sequence

Length: 2949 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1744 bp
Genome contig ID gi42406306f_54796651
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGACGACAGAGCAAGACTCTGTCTC
Flanking genome sequence
(110763 - 110812)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGAGGGTGATGTTGAGAAAGGATGCGTCAGCAGA

Features of the protein sequence

Length: 400 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92121 1.4e-164 100.0 carnitine palmi...
Homo sapiens
EAW52526 4.3e-147 100.0 carnitine palmi...
Homo sapiens
EAW52533 4.7e-147 100.0 carnitine palmi...
Homo sapiens
BAF82402 5.1e-147 100.0 unnamed protein...
Homo sapiens
Q8TCG5 5.1e-147 100.0 Carnitine O-pal...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000542 1 400 PF00755 Acyltransferase ChoActase/COT/CPT
ScanRegExp IPR000542 234 261 PS00440 Acyltransferase ChoActase/COT/CPT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp