Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04689
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209883
Product ID ORK04689
Clone name ef06339
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CXXC1
cDNA sequence DNA sequence (2463 bp)
Predicted protein sequence (523 aa)
Description CpG-binding protein (PHD finger and CXXC domain-containing protein 1) (CXXC-type zinc finger protein 1).
Features of the cloned cDNA sequence

Length: 2463 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 244 bp
Genome contig ID gi51511735r_45962717
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCCCTGGGTTTTGTTAATAAAATTTTGAAGAAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGAAGCTGTCTCCACATTGCTGCGGTTGCAACTGTTCCAGACTTCTGG

Features of the protein sequence

Length: 523 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93120 2e-194 100.0 CpG binding pro...
Homo sapiens
XP_001153715 4.5e-191 100.0 CXXC finger 1 (...
Pan troglodytes
XP_001153775 2.8e-188 97.3 CXXC finger 1 (...
Pan troglodytes
XP_001153829 2.9e-188 97.3 CXXC finger 1 (...
Pan troglodytes
Q9P0U4 3e-188 97.3 CpG-binding pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002857 28 75 PF02008 Zinc finger
ProfileScan IPR002857 27 76 PS51058 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp