Length: 5756 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
4720 bp |
Genome contig ID |
gi42406306r_53725762 |
PolyA signal sequence (GATAAA,-21) |
+----*----+----*----+----*----+---- GACGTGATAATGCAGATAAATACATTTATATTTTT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAGAAAAAGCGAGCCTCCCCCCTCCCTTGCGGGGGCGGGGAGGGTTCTCT |
Length: 248 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92044 |
1.4e-65 |
100.0 |
D site of album...
|
Homo sapiens
|
XP_512799 |
5.1e-62 |
99.5 |
similar to D si...
|
Pan troglodytes
|
Q10586 |
1e-46 |
100.0 |
D site-binding ...
|
Homo sapiens
|
AAP36478 |
1e-46 |
100.0 |
D site of album...
|
synthetic construct
|
AAA81374 |
1.4e-46 |
99.4 |
albumin D-box b...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.