Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04709
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208807
Product ID ORK04709
Clone name ah00519
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DBP
cDNA sequence DNA sequence (5756 bp)
Predicted protein sequence (248 aa)
Description D site-binding protein (Albumin D box-binding protein) (Albumin D- element-binding protein) (TAXREB302).
Features of the cloned cDNA sequence

Length: 5756 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4720 bp
Genome contig ID gi42406306r_53725762
PolyA signal sequence
(GATAAA,-21)
+----*----+----*----+----*----+----
GACGTGATAATGCAGATAAATACATTTATATTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAAAAGCGAGCCTCCCCCCTCCCTTGCGGGGGCGGGGAGGGTTCTCT

Features of the protein sequence

Length: 248 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92044 1.4e-65 100.0 D site of album...
Homo sapiens
XP_512799 5.1e-62 99.5 similar to D si...
Pan troglodytes
Q10586 1e-46 100.0 D site-binding ...
Homo sapiens
AAP36478 1e-46 100.0 D site of album...
synthetic construct
AAA81374 1.4e-46 99.4 albumin D-box b...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp