ORK04801

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04801

Order Kazusa clone(s) from :

Accession No	AB209923
Product ID	ORK04801
Clone name	ek00165
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DNAJA3
cDNA sequence	DNA sequence (2679 bp) Predicted protein sequence (478 aa)
Description	DnaJ homolog subfamily A member 3, mitochondrial precursor (Tumorous imaginal discs protein Tid56 homolog) (DnaJ protein Tid-1) (hTid-1) (Hepatocellular carcinoma-associated antigen 57).

Features of the cloned cDNA sequence

Description

Length: 2679 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1240 bp
Genome contig ID	gi51511732f_4315888
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAGATTATCTATTGCAAAAAGATATTTCAAACCT
Flanking genome sequence (130888 - 130937)	----+--------+--------+--------+--------+----* AAATTGTGGTCATTTCTTCTTTGAAAGAATTCAGACAGCCTCTGCAGGTG

Features of the protein sequence

Description

Length: 478 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93160	1.8e-194	100.0	DnaJ (Hsp40) ho...	Homo sapiens
AAC29066	1.8e-194	100.0	tumorous imagin...	Homo sapiens
AAH07225	6.8e-194	99.7	Unknown (protei...	Homo sapiens
Q96EY1	6.8e-194	99.7	DnaJ homolog su...	Homo sapiens
AAX42402	1.9e-193	99.5	DnaJ-like subfa...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003095	102	121	PR00625	Heat shock protein DnaJ
	IPR003095	133	153	PR00625	Heat shock protein DnaJ
	IPR003095	226	245	PR00625	Heat shock protein DnaJ
	IPR003095	251	261	PR00625	Heat shock protein DnaJ
	IPR003095	265	283	PR00625	Heat shock protein DnaJ
	IPR003095	285	300	PR00625	Heat shock protein DnaJ
	IPR003095	304	320	PR00625	Heat shock protein DnaJ
	IPR003095	341	358	PR00625	Heat shock protein DnaJ
HMMPfam	IPR001623	91	153	PF00226	Heat shock protein DnaJ
	IPR001305	221	301	PF00684	DnaJ central region
	IPR002939	305	426	PF01556	Chaperone DnaJ
HMMSmart	IPR001623	90	148	SM00271	Heat shock protein DnaJ
ProfileScan	IPR001623	91	156	PS50076	Heat shock protein DnaJ
ProfileScan	IPR001305	221	299	PS51188	DnaJ central region
ScanRegExp	IPR001623	133	152	PS00636	Heat shock protein DnaJ

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp