Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04828
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209787
Product ID ORK04828
Clone name bm02822
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DPP7
cDNA sequence DNA sequence (2097 bp)
Predicted protein sequence (377 aa)
Description Dipeptidyl-peptidase 2 precursor (EC 3.4.14.2) (Dipeptidyl-peptidase II) (DPP II) (Dipeptidyl aminopeptidase II) (Quiescent cell proline dipeptidase) (Dipeptidyl peptidase 7).
Features of the cloned cDNA sequence

Length: 2097 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 963 bp
Genome contig ID gi89161216r_139024814
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
AGGGGCTGAATAAACGCCTGGAGGCCTGGCCATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTCCCGTCCTTCCTGTCTGTGGGGCCCACACGCAGGCTGTGGGAGCGG

Features of the protein sequence

Length: 377 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93024 1.6e-153 100.0 Dipeptidyl-pept...
Homo sapiens
Q9UHL4 5.7e-120 100.0 Dipeptidyl pept...
Homo sapiens
AAF12747 1.3e-119 99.6 quiescent cell ...
Homo sapiens
CAH72872 1.7e-119 99.6 dipeptidyl-pept...
Homo sapiens
CAH89533 1.7e-118 98.3 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008758 37 377 PF05577 Peptidase S28
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp