Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04843
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226170
Product ID ORK04843
Clone name bj00123
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DUSP3
cDNA sequence DNA sequence (3681 bp)
Predicted protein sequence (136 aa)
Description Dual specificity protein phosphatase 3 (EC 3.1.3.48) (EC 3.1.3.16) (Dual specificity protein phosphatase VHR).
Features of the cloned cDNA sequence

Length: 3681 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3270 bp
Genome contig ID gi51511734r_39099406
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGTGCCACAAGTTAAGATGCTACTGTTTTAAAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGTACTGATCTTCAATATGAAGACATGAGCTTTTC

Features of the protein sequence

Length: 136 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001153398 2.1e-38 99.0 hypothetical pr...
Pan troglodytes
1J4X 1.6e-27 74.7

1VHR 2.3e-27 97.5

Q5RD73 2.3e-27 97.5 Dual specificit...
Pongo abelii
AAV38328 2.3e-27 97.5 dual specificit...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000340 1 83 PF00782 Protein-tyrosine phosphatase
HMMSmart IPR000340 1 136 SM00195 Protein-tyrosine phosphatase
ProfileScan IPR000340 1 99 PS50054 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp