ORK04851

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04851

Order Kazusa clone(s) from :

Accession No	AB209185
Product ID	ORK04851
Clone name	fj01818
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	E2F5
cDNA sequence	DNA sequence (4696 bp) Predicted protein sequence (248 aa)
Description	Transcription factor E2F5 (E2F-5).

Features of the cloned cDNA sequence

Description

Length: 4696 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3948 bp
Genome contig ID	gi51511724f_86177099
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGGTTCAGTAAAACTATTAAATTGAAGCTTCACAC
Flanking genome sequence (139542 - 139591)	----+--------+--------+--------+--------+----* ATTTGTAGTTAAAATGTTTATTTCTTTTCAACATTTGTTTTCAAGAAAGG

Features of the protein sequence

Description

Length: 248 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92422	6e-87	100.0	Transcription f...	Homo sapiens
Q15329	5.3e-86	100.0	Transcription f...	Homo sapiens
AAC50120	5.3e-85	99.5	E2F-5 [Homo sap...	Homo sapiens
CAB01634	5.3e-85	99.5	transcription f...	Homo sapiens
XP_001094919	9.2e-85	98.3	E2F transcripti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003316	1	52	PF02319	Transcription factor E2F/dimerisation partner (TDP)

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp