ORK04855

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04855

Order Kazusa clone(s) from :

Accession No	AB209064
Product ID	ORK04855
Clone name	hk00321
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EEF1A2
cDNA sequence	DNA sequence (3996 bp) Predicted protein sequence (340 aa)
Description	Elongation factor 1-alpha 2 (EF-1-alpha-2) (Elongation factor 1 A-2) (eEF1A-2) (Statin S1).

Features of the cloned cDNA sequence

Description

Length: 3996 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	332 bp
Genome contig ID	gi51511747r_61492162
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCTGCGTGACAGAGCGAGACTTCGTCTCAAAAG
Flanking genome sequence (99716 - 99667)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAGGGACCCGCATACCACCGAGGGGGCCACCGAG

Features of the protein sequence

Description

Length: 340 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92301	1.1e-143	100.0	eukaryotic tran...	Homo sapiens
AAA91835	6.7e-122	99.6	elongation fact...	Homo sapiens
Q05639	7.1e-122	99.6	Elongation fact...	Homo sapiens
AAV38606	7.1e-122	99.6	eukaryotic tran...	synthetic construct
AAX43357	7.1e-122	99.6	eukaryotic tran...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	44	52	PR00315	Protein synthesis factor
	IPR000795	64	74	PR00315	Protein synthesis factor
	IPR000795	80	91	PR00315	Protein synthesis factor
	IPR000795	124	133	PR00315	Protein synthesis factor
HMMPfam	IPR000795	24	215	PF00009	Protein synthesis factor
HMMPfam	IPR004161	236	303	PF03144	Translation elongation factor EFTu/EF1A
ScanRegExp	IPR000795	37	52	PS00301	Protein synthesis factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp