ORK04857

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04857

Order Kazusa clone(s) from :

Accession No	AB209442
Product ID	ORK04857
Clone name	pj02276
Vector information	The cDNA fragment was inserted at the NotI-SalI site of the ... The cDNA fragment was inserted at the NotI-SalI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was ligated at the NotI site and the 3' end of the cDNA was inserted at the SalI site of the vector. The adjacent sequences to the cDNA are as follows: 3' end of cDNA-CGGACGCGTG G.
Symbol	EGFR
cDNA sequence	DNA sequence (4050 bp) Predicted protein sequence (1081 aa)
Description	Epidermal growth factor receptor precursor (EC 2.7.10.1) (Receptor tyrosine-protein kinase ErbB-1).

Features of the cloned cDNA sequence

Description

Length: 4050 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	272 bp
Genome contig ID	gi89161213f_54954319
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGTCCCTTTGAGCAGAAATTTATCTTTCAAAGAG
Flanking genome sequence (286759 - 286808)	----+--------+--------+--------+--------+----* GTATATTTGAAAAAAAAAAAAAGTATATGTGAGGATTTTTATTGATTGGG

Features of the protein sequence

Description

Length: 1081 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92679	100.0	epidermal growt...	Homo sapiens
AAT52212	98.5	cell growth inh...	Homo sapiens
P00533	98.5	Epidermal growt...	Homo sapiens
AAX41033	98.5	epidermal growt...	synthetic construct
AAZ66620	98.4	cell proliferat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	587	846	PD000001	Protein kinase
FPrintScan	IPR001245	661	674	PR00109	Tyrosine protein kinase
	IPR001245	698	716	PR00109	Tyrosine protein kinase
	IPR001245	747	757	PR00109	Tyrosine protein kinase
	IPR001245	766	788	PR00109	Tyrosine protein kinase
	IPR001245	810	832	PR00109	Tyrosine protein kinase
HMMPfam	IPR006211	55	209	PF00757	Furin-like cysteine rich region
	IPR000494	232	352	PF01030	EGF receptor
	IPR001245	583	839	PF07714	Tyrosine protein kinase
HMMSmart	IPR006212	99	141	SM00261	Furin-like repeat
	IPR006212	367	418	SM00261	Furin-like repeat
	IPR006212	423	472	SM00261	Furin-like repeat
	IPR001245	583	839	SM00219	Tyrosine protein kinase
	IPR002290	583	840	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	583	850	PS50011	Protein kinase
ScanRegExp	IPR000719	589	616	PS00107	Protein kinase
ScanRegExp	IPR008266	704	716	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	517	IATGMVGALLLLLVVALGIGLFM	539	PRIMARY	23