Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04869
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209532
Product ID ORK04869
Clone name aj00822
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EIF2B4
cDNA sequence DNA sequence (4287 bp)
Predicted protein sequence (171 aa)
Description Translation initiation factor eIF-2B subunit delta (eIF-2B GDP-GTP exchange factor subunit delta).
Features of the cloned cDNA sequence

Length: 4287 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3054 bp
Genome contig ID gi89161199r_27342047
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CATCCTGGCTAACACAGTGAAACCCCGTCTCTACT
Flanking genome sequence
(99882 - 99833)
----+----*----+----*----+----*----+----*----+----*
AAAAATACAAAAAATTAGCCGGGCGTGGTGGTGGGCGCCTGTAGTCCCAG

Features of the protein sequence

Length: 171 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92769 2e-53 100.0 eukaryotic tran...
Homo sapiens
CAB57260 1.2e-41 100.0 guanine nucleot...
Homo sapiens
AAY14843 1.2e-41 100.0 unknown [Homo s...
Homo sapiens
CAB57305 1.3e-41 100.0 guanine nucleot...
Homo sapiens
CAB57261 1.3e-41 100.0 guanine nucleot...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp