Length: 4287 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
3054 bp |
Genome contig ID |
gi89161199r_27342047 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- CATCCTGGCTAACACAGTGAAACCCCGTCTCTACT |
Flanking genome sequence (99882 - 99833) |
----+----*----+----*----+----*----+----*----+----* AAAAATACAAAAAATTAGCCGGGCGTGGTGGTGGGCGCCTGTAGTCCCAG |
Length: 171 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92769 |
2e-53 |
100.0 |
eukaryotic tran...
|
Homo sapiens
|
CAB57260 |
1.2e-41 |
100.0 |
guanine nucleot...
|
Homo sapiens
|
AAY14843 |
1.2e-41 |
100.0 |
unknown [Homo s...
|
Homo sapiens
|
CAB57305 |
1.3e-41 |
100.0 |
guanine nucleot...
|
Homo sapiens
|
CAB57261 |
1.3e-41 |
100.0 |
guanine nucleot...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.