Length: 5248 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
1722 bp |
| Genome contig ID |
gi89161213f_2270434 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TAGCCTGAGCAACATAGCGAAACCCTAGCCCCATT |
Flanking genome sequence (112061 - 112110) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAGACTTTTTAAGCTGTTGACCACTCTCCTTG |
Length: 170 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92618 |
3e-76 |
100.0 |
eukaryotic tran...
|
Homo sapiens
|
| XP_862133 |
7.1e-71 |
99.3 |
similar to Euka...
|
Canis lupus fam...
|
| XP_850719 |
7.1e-71 |
99.3 |
similar to Euka...
|
Canis lupus fam...
|
| EAL23952 |
7.3e-71 |
99.3 |
eukaryotic tran...
|
Homo sapiens
|
| XP_536894 |
7.4e-71 |
99.3 |
similar to Euka...
|
Canis lupus fam...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method |
interpro_ID |
From |
To |
Entry |
Definition |
| HMMPfam |
IPR013979 |
47 |
170 |
PF08662 |
Eukaryotic translation initiation factor 2A |