Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04872
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209381
Product ID ORK04872
Clone name fh19134
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EIF3B
cDNA sequence DNA sequence (5248 bp)
Predicted protein sequence (170 aa)
Description Eukaryotic translation initiation factor 3 subunit 9 (eIF-3 eta) (eIF3 p116) (eIF3 p110) (eIF3b) (Prt1 homolog) (hPrt1).
Features of the cloned cDNA sequence

Length: 5248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1722 bp
Genome contig ID gi89161213f_2270434
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAGCCTGAGCAACATAGCGAAACCCTAGCCCCATT
Flanking genome sequence
(112061 - 112110)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGACTTTTTAAGCTGTTGACCACTCTCCTTG

Features of the protein sequence

Length: 170 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92618 3e-76 100.0 eukaryotic tran...
Homo sapiens
XP_862133 7.1e-71 99.3 similar to Euka...
Canis lupus fam...
XP_850719 7.1e-71 99.3 similar to Euka...
Canis lupus fam...
EAL23952 7.3e-71 99.3 eukaryotic tran...
Homo sapiens
XP_536894 7.4e-71 99.3 similar to Euka...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013979 47 170 PF08662 Eukaryotic translation initiation factor 2A
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp