ORK04875

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04875

Order Kazusa clone(s) from :

Accession No	AB209519
Product ID	ORK04875
Clone name	fk09431
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF4E2
cDNA sequence	DNA sequence (3443 bp) Predicted protein sequence (243 aa)
Description	Eukaryotic translation initiation factor 4E type 2 (eIF4E type 2) (eIF-4E type 2) (mRNA cap-binding protein type 3) (Eukaryotic translation initiation factor 4E-like 3) (Eukaryotic translation initiation factor 4E homologous protein) (mRNA cap-binding pro

Features of the cloned cDNA sequence

Description

Length: 3443 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2696 bp
Genome contig ID	gi89161199f_233023637
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTATCTACTGCAGTAATAAATTGAAAATATCAGC
Flanking genome sequence (132958 - 133007)	----+--------+--------+--------+--------+----* AAGAACCAGGTCGTGGACTTGTCAATACAAGGGAACCGGGGGTACTGTTA

Features of the protein sequence

Description

Length: 243 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92756	1.8e-102	100.0	eukaryotic tran...	Homo sapiens
EAW71008	2.9e-98	100.0	eukaryotic tran...	Homo sapiens
EDL40176	5.4e-97	98.2	eukaryotic tran...	Mus musculus
BAB31251	8.6e-97	97.8	unnamed protein...	Mus musculus
EDL40179	1.5e-95	97.8	eukaryotic tran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001040	63	230	PD003697	Eukaryotic translation initiation factor 4E (eIF-4E)
HMMPfam	IPR001040	27	243	PF01652	Eukaryotic translation initiation factor 4E (eIF-4E)
ScanRegExp	IPR001040	121	144	PS00813	Eukaryotic translation initiation factor 4E (eIF-4E)

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp