ORK04885

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04885

Order Kazusa clone(s) from :

Accession No	AB208942
Product ID	ORK04885
Clone name	fk13065
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ELN
cDNA sequence	DNA sequence (3147 bp) Predicted protein sequence (106 aa)
Description	Elastin precursor (Tropoelastin).

Features of the cloned cDNA sequence

Description

Length: 3147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2788 bp
Genome contig ID	gi89161213f_72980429
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGATAGATCAATAAATATTTTATTTTTTGTCCTGG
Flanking genome sequence (141516 - 141565)	----+--------+--------+--------+--------+----* ATATTTGGGGATTATTTTTGATTGTTGATATTCTCTTTTGGTTTTATTGT

Features of the protein sequence

Description

Length: 106 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92179	2.4e-44	100.0	Elastin precurs...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	78	CLVEWLTLLQPIKLLRLALGLVV	100	PRIMARY	23