Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05013
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209719
Product ID ORK05013
Clone name bm02070
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FEZ2
cDNA sequence DNA sequence (1732 bp)
Predicted protein sequence (253 aa)
Description Fasciculation and elongation protein zeta 2 (Zygin-2) (Zygin II).
Features of the cloned cDNA sequence

Length: 1732 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 968 bp
Genome contig ID gi89161199r_36532910
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CAAATCAATGGCATTTAATAAATTTTTTAAGAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATACATGTTTGAGAGCCTTATATTTGGGAGTTTTGTGTTGTATTTT

Features of the protein sequence

Length: 253 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92956 3.5e-86 100.0 fasciculation a...
Homo sapiens
EAX00425 4e-86 100.0 fasciculation a...
Homo sapiens
Q9UHY8 1.4e-84 99.2 Fasciculation a...
Homo sapiens
AAI10387 1.4e-84 99.2 Fasciculation a...
Homo sapiens
AAH89390 1.5e-84 99.6 FEZ2 protein [H...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011680 1 237 PF07763 FEZ-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp