Length: 5553 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
4466 bp |
Genome contig ID |
gi51511734f_7183549 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TGGGAGGTGGACTTGGACCCGAGAGGATGGGGCTC |
Flanking genome sequence (106462 - 106511) |
----+----*----+----*----+----*----+----*----+----* AGAAAAAGGGGGCGGCGTTCCCAGGAGAGAGGTTGGCCCCCCGAGCCCCC |
Length: 347 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92627 |
1.6e-121 |
100.0 |
fibroblast grow...
|
Homo sapiens
|
XP_001170209 |
4.2e-15 |
100.0 |
similar to Fgf1...
|
Pan troglodytes
|
Q92914 |
4.7e-15 |
100.0 |
Fibroblast grow...
|
Homo sapiens
|
XP_849741 |
4.7e-15 |
100.0 |
similar to Fibr...
|
Canis lupus fam...
|
XP_001108934 |
4.7e-15 |
100.0 |
fibroblast grow...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.