Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05018
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209390
Product ID ORK05018
Clone name fh20564
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FGF11
cDNA sequence DNA sequence (5553 bp)
Predicted protein sequence (347 aa)
Description Fibroblast growth factor 11 (FGF-11) (Fibroblast growth factor homologous factor 3) (FHF-3).
Features of the cloned cDNA sequence

Length: 5553 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4466 bp
Genome contig ID gi51511734f_7183549
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGAGGTGGACTTGGACCCGAGAGGATGGGGCTC
Flanking genome sequence
(106462 - 106511)
----+----*----+----*----+----*----+----*----+----*
AGAAAAAGGGGGCGGCGTTCCCAGGAGAGAGGTTGGCCCCCCGAGCCCCC

Features of the protein sequence

Length: 347 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92627 1.6e-121 100.0 fibroblast grow...
Homo sapiens
XP_001170209 4.2e-15 100.0 similar to Fgf1...
Pan troglodytes
Q92914 4.7e-15 100.0 Fibroblast grow...
Homo sapiens
XP_849741 4.7e-15 100.0 similar to Fibr...
Canis lupus fam...
XP_001108934 4.7e-15 100.0 fibroblast grow...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp