Length: 5862 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
4829 bp |
| Genome contig ID |
gi89161190f_68152247 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- AATAAAACCCCAATAAAACGTTTGGTCGGATATCT |
Flanking genome sequence (107587 - 107636) |
----+----*----+----*----+----*----+----*----+----* ACTTAAAAGTTTTATTGTATTTATATTTCACATACTACTTGAAACTTTGT |
Length: 343 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| AAB92554 |
5.4e-133 |
100.0 |
FGFR signalling...
|
Homo sapiens
|
| Q8WU20 |
5.5e-133 |
100.0 |
Fibroblast grow...
|
Homo sapiens
|
| XP_522464 |
2.3e-132 |
99.4 |
fibroblast grow...
|
Pan troglodytes
|
| XP_850500 |
4.1e-132 |
98.8 |
similar to fibr...
|
Canis lupus fam...
|
| XP_581582 |
2.6e-130 |
97.3 |
similar to fibr...
|
Bos taurus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.