Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05234
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226068
Product ID ORK05234
Clone name fh21869
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FRS2
cDNA sequence DNA sequence (5862 bp)
Predicted protein sequence (343 aa)
Description Fibroblast growth factor receptor substrate 2 (FGFR substrate 2) (Suc1-associated neurotrophic factor target 1) (SNT-1) (FGFR-signaling adaptor SNT).
Features of the cloned cDNA sequence

Length: 5862 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4829 bp
Genome contig ID gi89161190f_68152247
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AATAAAACCCCAATAAAACGTTTGGTCGGATATCT
Flanking genome sequence
(107587 - 107636)
----+----*----+----*----+----*----+----*----+----*
ACTTAAAAGTTTTATTGTATTTATATTTCACATACTACTTGAAACTTTGT

Features of the protein sequence

Length: 343 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAB92554 5.4e-133 100.0 FGFR signalling...
Homo sapiens
Q8WU20 5.5e-133 100.0 Fibroblast grow...
Homo sapiens
XP_522464 2.3e-132 99.4 fibroblast grow...
Pan troglodytes
XP_850500 4.1e-132 98.8 similar to fibr...
Canis lupus fam...
XP_581582 2.6e-130 97.3 similar to fibr...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp