Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05237
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK05237
Clone name bn03622
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FTH1
cDNA sequence DNA sequence (936 bp)
Predicted protein sequence (220 aa)
Flexi ORF Clone FXC05237
Description ferritin, heavy polypeptide 1
Features of the cloned cDNA sequence

Length: 936 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 161 bp
Genome contig ID gi51511727r_61388614
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGTACCATTCCTTCAAATAAAGAAATTTGGTACCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGTGTTGTCTTTGAGGTCTTGGGATGAATCAGAAATCTATCCAGGCTAT

Features of the protein sequence

Length: 220 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001140124 3.9e-89 100.0 similar to Ferr...
Pan troglodytes
AAI05803 4.3e-76 88.1 FTH1 protein [H...
Homo sapiens
AAH70494 5.5e-76 87.7 FTH1 protein [H...
Homo sapiens
P02794 1.7e-72 100.0 Ferritin heavy ...
Homo sapiens
Q5R8J7 2.7e-72 99.4 Ferritin heavy ...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001519 38 110 PD000971 Ferritin
HMMPfam IPR008331 55 196 PF00210 Ferritin and Dps
ProfileScan IPR009040 48 197 PS50905 Ferritin-like
ScanRegExp IPR014034 99 117 PS00540 Ferritin
IPR014034 164 184 PS00204 Ferritin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp