Length: 6911 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
684 bp |
Genome contig ID |
gi89161213r_99494803 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- CATGTTTGTTGAATGAATAAATAATTTGAAACTTC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* TACTTGATTTATGGAGGGTGGAAAGGGGAGGGATGGAGAATCTTCCTGGG |
Length: 524 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92381 |
6.4e-209 |
100.0 |
galactose-3-O-s...
|
Homo sapiens
|
AAH12976 |
1.3e-192 |
100.0 |
Galactose-3-O-s...
|
Homo sapiens
|
Q96RP7 |
2.6e-192 |
99.7 |
Galactose-3-O-s...
|
Homo sapiens
|
BAB13977 |
1.1e-191 |
99.3 |
unnamed protein...
|
Homo sapiens
|
BAG52541 |
1.4e-191 |
99.3 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR009729 |
39 |
507 |
PF06990 |
Galactose-3-O-sulphotransferase |