ORK05259

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05259

Order Kazusa clone(s) from :

Accession No	AB209144
Product ID	ORK05259
Clone name	fg05857
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GAL3ST4
cDNA sequence	DNA sequence (6911 bp) Predicted protein sequence (524 aa)
Description	Galactose-3-O-sulfotransferase 4 (EC 2.8.2.-) (Galbeta1-3GalNAc 3'- sulfotransferase) (Beta-galactose-3-O-sulfotransferase 4).

Features of the cloned cDNA sequence

Description

Length: 6911 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	684 bp
Genome contig ID	gi89161213r_99494803
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATGTTTGTTGAATGAATAAATAATTTGAAACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TACTTGATTTATGGAGGGTGGAAAGGGGAGGGATGGAGAATCTTCCTGGG

Features of the protein sequence

Description

Length: 524 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92381	6.4e-209	100.0	galactose-3-O-s...	Homo sapiens
AAH12976	1.3e-192	100.0	Galactose-3-O-s...	Homo sapiens
Q96RP7	2.6e-192	99.7	Galactose-3-O-s...	Homo sapiens
BAB13977	1.1e-191	99.3	unnamed protein...	Homo sapiens
BAG52541	1.4e-191	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009729	39	507	PF06990	Galactose-3-O-sulphotransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp