ORK05281

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05281

Order Kazusa clone(s) from :

Accession No	AB208912
Product ID	ORK05281
Clone name	sj07517
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GBP1
cDNA sequence	DNA sequence (4639 bp) Predicted protein sequence (282 aa)
Description	Interferon-induced guanylate-binding protein 1 (GTP-binding protein 1) (Guanine nucleotide-binding protein 1) (GBP-1) (HuGBP-1).

Features of the cloned cDNA sequence

Description

Length: 4639 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2447 bp
Genome contig ID	gi89161185r_89190589
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TTATAGCAATTAAAAATTATTTTTGAACTGAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATGTATTTCACTAGGCTTCTTATTTCTGATTTTCTTTTTTGCAGTTA

Features of the protein sequence

Description

Length: 282 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92149	4.7e-114	100.0	guanylate bindi...	Homo sapiens
AAX13805	1.9e-98	96.1	guanylate bindi...	Homo sapiens
CAI22972	3.1e-98	95.7	guanylate bindi...	Homo sapiens
BAG64827	4e-98	95.7	unnamed protein...	Homo sapiens
1DG3	4.2e-98	95.7	PROTEIN (INTERF...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015894	20	96	PF02263	Guanylate-binding protein
HMMPfam	IPR003191	98	281	PF02841	Guanylate-binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp