Length: 1738 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
841 bp |
| Genome contig ID |
gi51511734r_509336 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- ATTGTGTATTCATTGAATAAATTTTTTTTGAAAGT |
Flanking genome sequence (99986 - 99937) |
----+----*----+----*----+----*----+----*----+----* AAGCTTCTGAAATCAAGCTGTGATACCAGTCTCTAAGTCTCATCATGTAA |
Length: 298 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| AAG43141 |
8.9e-131 |
100.0 |
My027 protein [...
|
Homo sapiens
|
| AAG17987 |
1.7e-130 |
99.6 |
unknown [Homo s...
|
Homo sapiens
|
| BAF85004 |
2e-130 |
99.6 |
unnamed protein...
|
Homo sapiens
|
| AAH15848 |
2e-130 |
99.6 |
Glyoxalase doma...
|
Homo sapiens
|
| XP_511246 |
2.3e-130 |
99.6 |
similar to Chro...
|
Pan troglodytes
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method |
interpro_ID |
From |
To |
Entry |
Definition |
| HMMPfam |
IPR004360 |
5 |
104 |
PF00903 |
Glyoxalase/bleomycin resistance protein/dioxygenase |
| IPR004360 |
134 |
255 |
PF00903 |
Glyoxalase/bleomycin resistance protein/dioxygenase |