Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05302
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226083
Product ID ORK05302
Clone name bm01109
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GLOD4
cDNA sequence DNA sequence (1738 bp)
Predicted protein sequence (298 aa)
Description Glyoxalase domain-containing protein 4.
Features of the cloned cDNA sequence

Length: 1738 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 841 bp
Genome contig ID gi51511734r_509336
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTGTGTATTCATTGAATAAATTTTTTTTGAAAGT
Flanking genome sequence
(99986 - 99937)
----+----*----+----*----+----*----+----*----+----*
AAGCTTCTGAAATCAAGCTGTGATACCAGTCTCTAAGTCTCATCATGTAA

Features of the protein sequence

Length: 298 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAG43141 8.9e-131 100.0 My027 protein [...
Homo sapiens
AAG17987 1.7e-130 99.6 unknown [Homo s...
Homo sapiens
BAF85004 2e-130 99.6 unnamed protein...
Homo sapiens
AAH15848 2e-130 99.6 Glyoxalase doma...
Homo sapiens
XP_511246 2.3e-130 99.6 similar to Chro...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004360 5 104 PF00903 Glyoxalase/bleomycin resistance protein/dioxygenase
IPR004360 134 255 PF00903 Glyoxalase/bleomycin resistance protein/dioxygenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp