ORK05376

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05376

Order Kazusa clone(s) from :

Accession No	AB209389
Product ID	ORK05376
Clone name	fh20339
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GTF2IRD1
cDNA sequence	DNA sequence (5868 bp) Predicted protein sequence (967 aa)
Description	General transcription factor II-I repeat domain-containing protein 1 (GTF2I repeat domain-containing protein 1) (Muscle TFII-I repeat domain-containing protein 1) (General transcription factor III) (Slow- muscle-fiber enhancer-binding protein) (USE B1-bin

Features of the cloned cDNA sequence

Description

Length: 5868 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1294 bp
Genome contig ID	gi89161213f_73458258
PolyA signal sequence (AGTAAA,-11)	+--------+--------+----*----+---- CTGCCACCAAGGCCTTTTTAAATAAGTAAAAAAAG
Flanking genome sequence (196598 - 196647)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAGTGTTGCCTTTACTTTTACGGTCACTGTTTCATGT

Features of the protein sequence

Description

Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92626	100.0	GTF2I repeat do...	Homo sapiens
EAW69600	100.0	GTF2I repeat do...	Homo sapiens
AAF17358	99.8	putative transc...	Homo sapiens
AAD27668	99.8	putative transc...	Homo sapiens
XP_001082906	99.2	GTF2I repeat do...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004212	135	210	PF02946	GTF2I-like repeat
	IPR004212	358	433	PF02946	GTF2I-like repeat
	IPR004212	572	647	PF02946	GTF2I-like repeat
	IPR004212	697	772	PF02946	GTF2I-like repeat
	IPR004212	794	869	PF02946	GTF2I-like repeat
ProfileScan	IPR004212	126	220	PS51139	GTF2I-like repeat
	IPR004212	349	443	PS51139	GTF2I-like repeat
	IPR004212	563	657	PS51139	GTF2I-like repeat
	IPR004212	688	782	PS51139	GTF2I-like repeat
	IPR004212	785	879	PS51139	GTF2I-like repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp