ORK05456

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05456

Order Kazusa clone(s) from :

Accession No	AB208932
Product ID	ORK05456
Clone name	fh18168
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HSD17B4
cDNA sequence	DNA sequence (5539 bp) Predicted protein sequence (471 aa)
Description	Peroxisomal multifunctional enzyme type 2 (MFE-2) (D-bifunctional protein) (DBP) (17-beta-hydroxysteroid dehydrogenase 4) (17-beta-HSD 4) (D-3-hydroxyacyl-CoA dehydratase) (EC 4.2.1.107) (3-alpha,7- alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hy

Features of the cloned cDNA sequence

Description

Length: 5539 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1635 bp
Genome contig ID	gi51511721f_118716110
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- TTCTATATTCAATCATATTAAATACAAATAAAAAG
Flanking genome sequence (284685 - 284734)	----+--------+--------+--------+--------+----* AATTAGTTTTTTCCTTTTTATTTCTAGACGGCACTTTTATTTTTCTTCTG

Features of the protein sequence

Description

Length: 471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92169	2.2e-199	100.0	hydroxysteroid ...	Homo sapiens
EAW48910	3.8e-194	99.7	hydroxysteroid ...	Homo sapiens
P51659	4.4e-194	99.7	Peroxisomal mul...	Homo sapiens
BAG52804	9.5e-194	99.5	unnamed protein...	Homo sapiens
BAG35356	8.3e-193	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002539	235	356	PF01575	MaoC-like dehydratase
HMMPfam	IPR003033	379	471	PF02036	Sterol-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp