Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05456
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208932
Product ID ORK05456
Clone name fh18168
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HSD17B4
cDNA sequence DNA sequence (5539 bp)
Predicted protein sequence (471 aa)
Description Peroxisomal multifunctional enzyme type 2 (MFE-2) (D-bifunctional protein) (DBP) (17-beta-hydroxysteroid dehydrogenase 4) (17-beta-HSD 4) (D-3-hydroxyacyl-CoA dehydratase) (EC 4.2.1.107) (3-alpha,7- alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hy
Features of the cloned cDNA sequence

Length: 5539 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1635 bp
Genome contig ID gi51511721f_118716110
PolyA signal sequence
(AATAAA,-9)
+----*----+----*----+----*----+----
TTCTATATTCAATCATATTAAATACAAATAAAAAG
Flanking genome sequence
(284685 - 284734)
----+----*----+----*----+----*----+----*----+----*
AATTAGTTTTTTCCTTTTTATTTCTAGACGGCACTTTTATTTTTCTTCTG

Features of the protein sequence

Length: 471 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92169 2.2e-199 100.0 hydroxysteroid ...
Homo sapiens
EAW48910 3.8e-194 99.7 hydroxysteroid ...
Homo sapiens
P51659 4.4e-194 99.7 Peroxisomal mul...
Homo sapiens
BAG52804 9.5e-194 99.5 unnamed protein...
Homo sapiens
BAG35356 8.3e-193 99.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002539 235 356 PF01575 MaoC-like dehydratase
IPR003033 379 471 PF02036 Sterol-binding
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp