Length: 7058 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
6503 bp |
Genome contig ID |
gi51511727f_6481616 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- GCCCCGCCTGTCACAATAAAGTTTATTATGAAAAC |
Flanking genome sequence (107064 - 107113) |
----+----*----+----*----+----*----+----*----+----* AGGCTGGTGTGGGGACATGGGGACAGATAAGTACATTTAGGTTGGGTGGC |
Length: 128 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92653 |
6.8e-50 |
100.0 |
integrin-linked...
|
Homo sapiens
|
EDL16811 |
9.4e-06 |
100.0 |
mCG19714, isofo...
|
Mus musculus
|
EDM18003 |
9.4e-06 |
100.0 |
integrin linked...
|
Rattus norvegicus
|
EDM18010 |
1.2e-05 |
100.0 |
integrin linked...
|
Rattus norvegicus
|
EDL16808 |
1.5e-05 |
100.0 |
mCG19714, isofo...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.