Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05516
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209416
Product ID ORK05516
Clone name pf00882
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ILK
cDNA sequence DNA sequence (7058 bp)
Predicted protein sequence (128 aa)
Description Integrin-linked protein kinase (EC 2.7.11.1) (ILK-1) (ILK-2) (59 kDa serine/threonine-protein kinase) (p59ILK).
Features of the cloned cDNA sequence

Length: 7058 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 6503 bp
Genome contig ID gi51511727f_6481616
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GCCCCGCCTGTCACAATAAAGTTTATTATGAAAAC
Flanking genome sequence
(107064 - 107113)
----+----*----+----*----+----*----+----*----+----*
AGGCTGGTGTGGGGACATGGGGACAGATAAGTACATTTAGGTTGGGTGGC

Features of the protein sequence

Length: 128 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92653 6.8e-50 100.0 integrin-linked...
Homo sapiens
EDL16811 9.4e-06 100.0 mCG19714, isofo...
Mus musculus
EDM18003 9.4e-06 100.0 integrin linked...
Rattus norvegicus
EDM18010 1.2e-05 100.0 integrin linked...
Rattus norvegicus
EDL16808 1.5e-05 100.0 mCG19714, isofo...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp