ORK05534

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05534

Order Kazusa clone(s) from :

Accession No	AB209403
Product ID	ORK05534
Clone name	fh23263
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IREB2
cDNA sequence	DNA sequence (5381 bp) Predicted protein sequence (802 aa)
Description	Iron-responsive element-binding protein 2 (IRE-BP 2) (Iron regulatory protein 2) (IRP2).

Features of the cloned cDNA sequence

Description

Length: 5381 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2972 bp
Genome contig ID	gi51511731f_76417711
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGTTTACTATACCTTGGGTAATTTTGTGTTACC
Flanking genome sequence (162226 - 162275)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGGAAGTGTAATGTCAGACACACAAGAAAAGC

Features of the protein sequence

Description

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92640	100.0	iron-responsive...	Homo sapiens
ABF47091	99.8	iron-responsive...	Homo sapiens
P48200	99.7	Iron-responsive...	Homo sapiens
BAF85681	99.5	unnamed protein...	Homo sapiens
XP_001149640	99.4	iron-responsive...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001030	279	508	PD000511	Aconitate hydratase
BlastProDom	IPR001030	543	672	PD000511	Aconitate hydratase
FPrintScan	IPR001030	250	263	PR00415	Aconitate hydratase
	IPR001030	274	282	PR00415	Aconitate hydratase
	IPR001030	303	316	PR00415	Aconitate hydratase
	IPR001030	317	332	PR00415	Aconitate hydratase
	IPR001030	379	392	PR00415	Aconitate hydratase
	IPR001030	393	406	PR00415	Aconitate hydratase
	IPR001030	475	489	PR00415	Aconitate hydratase
	IPR001030	540	551	PR00415	Aconitate hydratase
	IPR001030	602	615	PR00415	Aconitate hydratase
HMMPfam	IPR001030	90	671	PF00330	Aconitate hydratase
ScanRegExp	IPR001030	536	552	PS00450	Aconitate hydratase
ScanRegExp	IPR001030	602	615	PS01244	Aconitate hydratase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp