Length: 5152 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
3088 bp |
| Genome contig ID |
gi51511721r_131746676 |
PolyA signal sequence (AGTAAA,-14) |
+----*----+----*----+----*----+---- TACATTTGTCTTTTTATAAAAAGTAAATTGTTTAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAGGGGTGTGGCCTTTTTAGAGAGAAATTTAACTTGTAGATGATTTTACT |
Length: 229 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92861 |
2.4e-96 |
100.0 |
interferon regu...
|
Homo sapiens
|
| BAG60912 |
9.7e-13 |
58.0 |
unnamed protein...
|
Homo sapiens
|
| BAD89424 |
1.7e-11 |
51.0 |
interferon regu...
|
Homo sapiens
|
| P10914 |
2.1e-11 |
51.0 |
Interferon regu...
|
Homo sapiens
|
| AAV38559 |
2.1e-11 |
51.0 |
interferon regu...
|
synthetic construct
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.