Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05535
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209624
Product ID ORK05535
Clone name sh02382
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IRF1
cDNA sequence DNA sequence (5152 bp)
Predicted protein sequence (229 aa)
Description Interferon regulatory factor 1 (IRF-1).
Features of the cloned cDNA sequence

Length: 5152 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3088 bp
Genome contig ID gi51511721r_131746676
PolyA signal sequence
(AGTAAA,-14)
+----*----+----*----+----*----+----
TACATTTGTCTTTTTATAAAAAGTAAATTGTTTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGGGTGTGGCCTTTTTAGAGAGAAATTTAACTTGTAGATGATTTTACT

Features of the protein sequence

Length: 229 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92861 2.4e-96 100.0 interferon regu...
Homo sapiens
BAG60912 9.7e-13 58.0 unnamed protein...
Homo sapiens
BAD89424 1.7e-11 51.0 interferon regu...
Homo sapiens
P10914 2.1e-11 51.0 Interferon regu...
Homo sapiens
AAV38559 2.1e-11 51.0 interferon regu...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp