ORK05545

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05545

Order Kazusa clone(s) from :

Accession No	AB208842
Product ID	ORK05545
Clone name	fh16374
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGA6
cDNA sequence	DNA sequence (5199 bp) Predicted protein sequence (566 aa)
Description	Integrin alpha-6 precursor (VLA-6) (CD49f antigen) [Contains: Integrin alpha-6 heavy chain; Integrin alpha-6 light chain].

Features of the cloned cDNA sequence

Description

Length: 5199 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2022 bp
Genome contig ID	gi89161199f_172900861
PolyA signal sequence (TATAAA,-32)	+--------+--------+----*----+---- AATTATAAATGACAACCTGAATTATCTATTTCATC
Flanking genome sequence (178389 - 178438)	----+--------+--------+--------+--------+----* AAACCAAAGTTCAGTGTTTTTATTTTTGGTGTCTCATGTAATCTCAGATC

Features of the protein sequence

Description

Length: 566 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92079	100.0	Integrin alpha-...	Homo sapiens
EAX11177	100.0	integrin, alpha...	Homo sapiens
EAX11175	100.0	integrin, alpha...	Homo sapiens
P23229	99.8	Integrin alpha-...	Homo sapiens
XP_515909	99.4	integrin alpha ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000413	50	63	PR01185	Integrins alpha chain
FPrintScan	IPR000413	500	519	PR01185	Integrins alpha chain
HMMPfam	IPR013649	1	414	PF08441	Integrin alpha-2
ScanRegExp	IPR013513	512	519	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	491	WIILVAILAGILMLALLVFILWK	513	PRIMARY	23