Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05800
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208922
Product ID ORK05800
Clone name ae00022
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LAMA2
cDNA sequence DNA sequence (5777 bp)
Predicted protein sequence (1853 aa)
Description Laminin subunit alpha-2 precursor (Laminin M chain) (Merosin heavy chain).
Features of the cloned cDNA sequence

Length: 5777 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 213 bp
Genome contig ID gi89161210f_129578658
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
CAAGTCTATAAATATTAAACTGATTATTTCATTCT
Flanking genome sequence
(300745 - 300794)
----+----*----+----*----+----*----+----*----+----*
AAATAATTGCCTGTTTTGTGTGATTTTAAGGATAAAAGGTAACTGGCCAT

Features of the protein sequence

Length: 1853 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92159 0 100.0 laminin alpha 2...
Homo sapiens
NP_001073291 0 99.9 laminin subunit...
Homo sapiens
CAH70492 0 99.7 laminin, alpha ...
Homo sapiens
NP_000417 0 99.7 laminin subunit...
Homo sapiens
EAW48082 0 99.8 laminin, alpha ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000034 1 63 PD003031 Laminin B
NULL 693 879 PD031131 NULL
FPrintScan IPR002049 108 126 PR00011 EGF-like
IPR002049 245 273 PR00011 EGF-like
IPR002049 274 292 PR00011 EGF-like
HMMPfam IPR000034 1 113 PF00052 Laminin B
IPR002049 115 152 PF00053 EGF-like
IPR002049 155 201 PF00053 EGF-like
IPR002049 204 259 PF00053 EGF-like
IPR002049 262 297 PF00053 EGF-like
IPR009254 323 588 PF06008 Laminin I
IPR010307 772 908 PF06009 Laminin II
IPR012679 909 1049 PF00054 Laminin G
IPR012679 1103 1238 PF00054 Laminin G
IPR012679 1285 1426 PF00054 Laminin G
IPR012679 1524 1652 PF00054 Laminin G
IPR012680 1699 1827 PF02210 Laminin G
HMMSmart IPR000034 1 99 SM00281 Laminin B
IPR002049 115 152 SM00180 EGF-like
IPR002049 155 201 SM00180 EGF-like
IPR002049 204 259 SM00180 EGF-like
IPR002049 262 306 SM00180 EGF-like
IPR001791 901 1046 SM00282 Laminin G
IPR001791 1095 1235 SM00282 Laminin G
IPR001791 1277 1423 SM00282 Laminin G
IPR001791 1516 1649 SM00282 Laminin G
IPR001791 1691 1827 SM00282 Laminin G
ProfileScan IPR000034 1 114 PS51115 Laminin B
IPR002049 155 203 PS50027 EGF-like
IPR002049 204 261 PS50027 EGF-like
IPR002049 262 308 PS50027 EGF-like
IPR001791 880 1063 PS50025 Laminin G
IPR001791 1075 1252 PS50025 Laminin G
IPR001791 1257 1441 PS50025 Laminin G
IPR001791 1494 1665 PS50025 Laminin G
IPR001791 1670 1850 PS50025 Laminin G
ScanRegExp IPR013032 115 126 PS00022 EGF-like region
IPR013032 115 129 PS01186 EGF-like region
IPR002049 171 206 PS01248 EGF-like
IPR002049 229 264 PS01248 EGF-like
IPR013032 281 292 PS00022 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp