ORK05822

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05822

Order Kazusa clone(s) from :

Accession No	AB209408
Product ID	ORK05822
Clone name	fh24387
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LGI1
cDNA sequence	DNA sequence (5985 bp) Predicted protein sequence (394 aa)
Description	Leucine-rich glioma-inactivated protein 1 precursor (Epitempin-1).

Features of the cloned cDNA sequence

Description

Length: 5985 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	355 bp
Genome contig ID	gi89161187f_95438072
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAACTGCCAAATAAAATGTTTACATTTTCTTTCAT
Flanking genome sequence (109835 - 109884)	----+--------+--------+--------+--------+----* ATCCCAGAGGTAATTATTTACAGGAGCTGTTTCATTCTTGTTGTTGGTAT

Features of the protein sequence

Description

Length: 394 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92645	6.8e-174	100.0	leucine-rich, g...	Homo sapiens
EAW50051	4.1e-172	99.2	leucine-rich, g...	Homo sapiens
O95970	4.6e-172	99.2	Leucine-rich gl...	Homo sapiens
Q1EGL2	1.6e-171	98.9	Leucine-rich gl...	Pan troglodytes
Q5R945	2.6e-171	98.9	Leucine-rich gl...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000483	34	59	PF01463	Cysteine-rich flanking region
	IPR005492	63	103	PF03736	EPTP
	IPR005492	257	298	PF03736	EPTP
HMMSmart	IPR000483	10	59	SM00082	Cysteine-rich flanking region
ProfileScan	IPR009039	61	104	PS50912	EAR
	IPR009039	107	150	PS50912	EAR
	IPR009039	153	201	PS50912	EAR
	IPR009039	202	252	PS50912	EAR
	IPR009039	255	299	PS50912	EAR
	IPR009039	300	343	PS50912	EAR
	IPR009039	346	389	PS50912	EAR

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp