Length: 5224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
4617 bp |
Genome contig ID |
gi89161185r_204734330 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- TTGAATTCTCCAAATAAAACTTAAAAAAGAAGTAG |
Flanking genome sequence (99682 - 99633) |
----+----*----+----*----+----*----+----*----+----* ACATTCTGTGTGATACAGAGAGTATCTGTCCCTCTAAATATGTAATACAT |
Length: 106 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92601 |
2.2e-39 |
100.0 |
ligatin variant...
|
Homo sapiens
|
EAW93538 |
7.6e-29 |
96.5 |
ligatin, isofor...
|
Homo sapiens
|
CAI13535 |
7.7e-29 |
96.5 |
ligatin [Homo s...
|
Homo sapiens
|
EAW93537 |
9e-29 |
96.5 |
ligatin, isofor...
|
Homo sapiens
|
P41214 |
1.5e-28 |
96.5 |
Ligatin; Hepato...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.