Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05823
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209364
Product ID ORK05823
Clone name fh16714
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EIF2D
cDNA sequence DNA sequence (5224 bp)
Predicted protein sequence (106 aa)
Description Ligatin (Hepatocellular carcinoma-associated antigen 56).
Features of the cloned cDNA sequence

Length: 5224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4617 bp
Genome contig ID gi89161185r_204734330
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTGAATTCTCCAAATAAAACTTAAAAAAGAAGTAG
Flanking genome sequence
(99682 - 99633)
----+----*----+----*----+----*----+----*----+----*
ACATTCTGTGTGATACAGAGAGTATCTGTCCCTCTAAATATGTAATACAT

Features of the protein sequence

Length: 106 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92601 2.2e-39 100.0 ligatin variant...
Homo sapiens
EAW93538 7.6e-29 96.5 ligatin, isofor...
Homo sapiens
CAI13535 7.7e-29 96.5 ligatin [Homo s...
Homo sapiens
EAW93537 9e-29 96.5 ligatin, isofor...
Homo sapiens
P41214 1.5e-28 96.5 Ligatin; Hepato...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp